XML to XML transformation via Smooks Mediator in WSO2 ESB


Smooks is an extensible framework for building applications for processing XML and non XML data (CSV, EDI, Java etc). This example demonstrates how xml to xml transformation can be done using the smooks mediator in WSO2 ESB. WSO2 ESB provides XSLT, FastXSLT, Enrich, PayloadFactory, Smooks and XQuery mediators to transform messages from XML to XML. Choice of a particular mediator out of these, depends on the complexity of the use case. For a simple transformation  enrich or PayloadFactory would be the best choice. For a complex transformation XSLT, FastXSLT, XQuery or Smooks can be used. In this article I will use smooks mediator for xml to xml transformation.


Having said that let’s get some hands on smooks using WSO2 ESB. For this sample I am using WSO2ESB 4.8.1 version. First locate the axis2.xml file under the \$ESB_HOME/repository/conf/axis2 directory and enable vfs transport. For this uncomment the vfs transport sender and receiver elements.  Then move on to \$ESB_HOME/bin directory and execute ./wso2server.sh startup script to start the ESB.
Smooks consists of a configuration file where all the transformation specific stuffs are stated. A sample smooks configuration [1] used for this article is given below. Also all the configurations used in this article can be found here [2].


Let’s place this smooks configuration file inside the registry. For this in the web interface under the main menu, click on browse, and create a collection named smooks under the _system/config. Then save the above configuration in your file system and name it as ‘smooks_config.xml’. Move on to the created collection named ‘smooks’ and add this configuration file as a resource to that.


Then go to the source view under the main menu and add the following proxy configuration.

The input that we need to transform is given below. Take that and save into a file named input.xml under the file system location specified for the transport.vfs.FileURI parameter.


The proxy will pick that up from the specified file system location via the vfs transport and transform it as specified in the smooks_config.xml file. Then the output will be logged in the ESB console. A sample output is given below.


Here I have covered only xml to xml transformation scenario via the smooks mediator. You may refer to our documentation sample [3] for text to xml transformation. There are lot more combinations remaining. I hope that you would try them out.
References

Comments

  1. UnknownJuly 12, 2015 at 7:55 PM

    is there anyway to transform without locating input fo smooks mediator in a specific file?
    I mean mapping message's content directly.

    ReplyDelete
  2. Ravindra RanwalaSeptember 3, 2015 at 11:41 PM

    No, You have to specify smooks configuration in a file and place it inside the registry and later you have to refer that file inside the smooks mediator using the config-key parameter. You can not map it directly.

    ReplyDelete

Post a Comment

Popular posts from this blog

Introducing Java Reactive Extentions in to a SpringBoot Micro Service

Image
Introduction Today we are going to take a look at Reactive Programming using Java8 and RxJava, which is a library for composing asynchronous and event-based programs by using observable sequences. RxJava stands for Reactive Extensions for the JVM. It extends the observer pattern [Gamma95] to support sequences of data/events and adds operators that allow you to compose sequences together declaratively while abstracting away concerns about things like low-level threading, synchronization, thread-safety and concurrent data structures [1]. Pre-Requisites : Having a good knowledge about Java8, Functional Programming and spring boot microservices. What is Reactive programming? In essence, Reactive programming is an asynchronous programming paradigm concerned with data streams. The system time, a list of entries from the DB/API, user clicks, everything can be a stream of data. Data from different streams can easily be combined and transformed, and in the end processed/observed by the
Read more

Optimal binary search trees

Image
Suppose that we are designing a program to translate text from English to French. For each occurrence of each English word in the text, we need to look up its French equivalent. We could perform these lookup operations by building a binary search tree with $n$ English words as keys and their French equivalents as satellite data. Because we will search the tree for each individual word in the text, we want the total time spent searching to be as low as possible. We could ensure an $Θ(log_2 \;n)$ search time per occurrence by using a red-black tree or any other balanced binary search tree. Words appear with different frequencies, however, and a frequently used word such as the may appear far from the root while a rarely used word appears near the root. Such an organization would slow down the translation, since the number of nodes visited when searching for a key in a binary search tree equals one plus the depth of the node containing the key. We want words that occur frequently in the t
Read more

Edit distance

Image
Biological applications often need to compare the DNA of two (or more) different organisms. A strand of DNA consists of a string of molecules called bases, where the possible bases are adenine, guanine, cytosine, and thymine. Representing each of these bases by its initial letter, we can express a strand of DNA as a string over the finite set $\{A, C, G, T\}$. For example, the DNA of one organism may be $S1 = ACCGGTCGAGTGCGCGGAAGCCGGCCGAA$, and the DNA of another organism may be $S2 = GTCGTTCGGAATGCCGTTGCTCTGTAAA$. One reason to compare two strands of DNA is to determine how “similar” the two strands are, as some measure of how closely related the two organisms are. We can, and do, define similarity in many different ways. For example, we can say that two strands are similar if the number of changes needed to turn one into the other is small. [1] We formalize this notion of similarity in our Edit distance problem. 15-5 Edit distance - Problem Statement In order to transform one sour
Read more