WSO2 ESB Worker Manager Cluster without a Load Balancer


INTRODUCTION
In production environments, services are clustered in order to scale up applications, achieve high availability or to achieve both. By scaling up, the application supports a larger number of user requests and through high availability the service is available even if few servers are down. To support balancing of load among these servers, a load balancer is used to distribute requests among the nodes in the cluster. The nodes that receive this incoming traffic are a set of backend worker nodes in a worker/manager separated cluster.

The worker/manager setup clearly separates the concerns/responsibilities, where the manager node is responsible for management related activities such as creating, updating and deleting synapse artefacts. The workers are responsible for serving client requests.

In this article I will elaborate the steps required to create a WSO2 ESB worker manager cluster without a load balancer. In a production setup load balancer becomes handy, but for our testing purposes we may not need a load balancer which fronts the nodes in the cluster. Instead we may straightaway direct the requests manually to the worker nodes in the cluster.

WORKSHOP
Having said that let me take you through the configurations necessary to set up the cluster. The deployment diagram which we are going to implement is depicted below.


  1. Deployment Diagram
Cluster-Deployment-Setup.png

Figure 1 : Cluster Deployment Diagram

You may download the WSO2 ESB 4.9.0 from here [2]. For further information on clustering WSO2 products, I recommend you to go through WSO2 clustering guide documentation [3].


2 Setting up user management and registry databases
  • Open a mysql shell and create a database as follows

  • Create database schema and populate tables as follows. Make sure to replace CARBON_HOME with the absolute path of wso2esb directory

  • Now, create another database which will be used as the shared governance and configuration registry database.

  • Create registry database schema and populate tables as follows. Make sure to replace CARBON_HOME with the absolute path of wso2esb directory


3 Setting up WSO2 ESB management node
  • Unzip wso2esb-4.9.0.zip into a directory in your local file system. Let the extracted directory be WSO2_ESB_MGR_HOME
  • Go to WSO2_ESB_MGR_HOME/repository/conf and open carbon.xml. Update the following elements


Make sure to replace SvnUrl, SvnUser and SvnPassword according to your SVN server.

  • Configure user management database and shared registry database by editing WSO2_ESB_MGR_HOME/repository/conf/datasoruces/master-datasources.xml as shown below.


Make sure to replace username and password with your mysql database username and password

  • Update WSO2_ESB_MGR_HOME/repository/conf/user-mgt.xml as shown below


  • Configure shared registry database and mounting details in WSO2_ESB_MGR_HOME/repository/conf/registry.xml as follows


This contains all the registry mounting details for configuration and governance registries. For more information please refer the clustering guide [3].

  • Open WSO2_ESB_MGR_HOME/repository/conf/axis2/axis2.xml and update the clustering configurations as shown below


This members section says that the well known address (wka) member of this node is the member which holds the given IP address and listens on the port 4200. This member will send a cluster message to the wka member when this node joins and leaves the cluster. Also make sure that you give the IP address of the node here. For more information regarding the wka members please refer the WSO2 carbon based products clustering guide [3].  

  • Uncomment and edit WSDLEPRPrefix element under org.apache.synapse.transport.passthru.PassThroughHttpListener and org.apache.synapse.transport.passthru.PassThroughHttpSSLListener in transportReceiver configurations in WSO2_ESB_MGR_HOME/repository/conf/axis2/axis2.xml as shown below

  • Then locate the local member host element and set it to your IP address as follows. Also take a note that you must give the IP address of the host machine here.

  • Leave the local member port element to default as follows.


  • Copy mysql jdbc driver (mysql-connector-java-5.1.19-bin.jar) to WSO2_ESB_MGR_HOME /repository/components/lib
  • Copy svnkit library (svnkit-all-1.8.7.wso2v1.jar) [4] to WSO2_ESB_MGR_HOME /repository/components/dropins
  • Now, start WSO2 ESB manager node by running
WSO2_ESB_MGR_HOME/bin/wso2server.sh -Dsetup

Upon a successful startup you may notice the following log printed in ESB console.
INFO - MemberUtils Added member: Host:192.168.1.100, Remote Host:null, Port: 4200, HTTP:-1, HTTPS:-1, Domain: null, Sub-domain:null, Active:true
INFO - HazelcastClusteringAgent Hazelcast initialized in 1283ms
INFO - HazelcastClusteringAgent Local member: [03fa03f7-176b-48d5-9173-48866d7dd641] - Host:192.168.1.100, Remote Host:null, Port: 4100, HTTP:8280, HTTPS:8243, Domain: wso2con.domain, Sub-domain:mgt, Active:true
INFO - HazelcastClusteringAgent Elected this member [03fa03f7-176b-48d5-9173-48866d7dd641] as the Coordinator node

You may access the manager nodes Administration web console via the following url.

The next step is to setup the Worker nodes for the cluster.

4 Setting up WSO2 ESB worker node

  • Unzip wso2esb-4.9.0.zip into a directory in your local file system. Let the extracted directory be WSO2_ESB_WORKER_HOME
  • Go to WSO2_ESB_WORKER_HOME/repository/conf and open carbon.xml. Update the following elements

Make sure to replace SvnUrl, SvnUser and SvnPassword according to your SVN server

  • Configure user management database and shared registry database by editing WSO2_ESB_WORKER_HOME/repository/conf/datasoruces/master-datasources.xml as shown below

Make sure to replace usename and password with your mysql database username and password

  • Update WSO2_ESB_WORKER_HOME/repository/conf/user-mgt.xml as shown below
  • Configure shared registry database and mounting details in WSO2_ESB_WORKER_HOME/repository/conf/registry.xml as follows

  • Open WSO2_ESB_WORKER_HOME/repository/conf/axis2/axis2.xml and update the clustering configurations as shown below
Here we configure the wka member for this worker node as the manager node, by specifying manager’s ip address and the port to which manager listens. Ideally in a production setup each node should register with two wka members, so that if one well known member is down still the node can communicate with the other wka member. That kind of a setup is not vulnerable to any single point of failures of well known members. But for the time being let’s have only one wka member since this is not a production setup.

  • Uncomment and edit WSDLEPRPrefix element under org.apache.synapse.transport.passthru.PassThroughHttpListener and org.apache.synapse.transport.passthru.PassThroughHttpSSLListener in transportReceiver configurations in WSO2_ESB_WORKER_HOME/repository/conf/axis2/axis2.xml as shown below
  • Copy mysql jdbc driver (mysql-connector-java-5.1.19-bin.jar) to WSO2_ESB_WORKER_HOME /repository/components/lib
  • Copy svnkit library (svnkit-all-1.8.7.wso2v1.jar) [4]  to WSO2_ESB_WORKER_HOME /repository/components/dropins
  • Now, start WSO2 ESB manager node by running
WSO2_ESB_WORKER_HOME/bin/wso2server.sh -DworkerNode=true

At successful startup this node will send a cluster message to it’s well known (wka member) which is the manager node. You may see the following log printed in manager (wka) node’s console when this worker node joins the cluster.

INFO - WKABasedMembershipScheme Member joined [057c1105-97b2-4c99-8b1d-4164127b5684]: /192.168.1.100:4200

5 Setting up another WSO2 ESB worker node
Now let set up another WSO2 ESB worker node to this cluster. This is very easy.
  • Take a copy of the previously created ESB worker node. Alternatively you may follow all the steps indicated in section 4 to create another worker node from the scratch. Despite of the method you choose here, make sure to apply following configuration changes to your setup.
  • Locate the WSO2_ESB_WORKER_HOME/repository/conf and open carbon.xml. Then change the following element
  • Open WSO2_ESB_WORKER_HOME/repository/conf/axis2/axis2.xml and update the clustering configurations as shown below
  • Copy mysql jdbc driver (mysql-connector-java-5.1.19-bin.jar) to WSO2_ESB_WORKER_HOME /repository/components/lib
  • Copy svnkit library (svnkit-all-1.8.7.wso2v1.jar) [4]  to WSO2_ESB_WORKER_HOME /repository/components/dropins
  • Now, start WSO2 ESB manager node by running
WSO2_ESB_WORKER_HOME/bin/wso2server.sh -DworkerNode=true

Note that we have specified two well known (wka) members (manager and worker1) for the worker2. Therefore when this starts you may see the member joined log on both manager and worker 1 ESB consoles.

In manager node’s console you may see following logs when the worker2 node joins the cluster
[2015-09-14 11:31:44,162]  INFO - WKABasedMembershipScheme Member joined [a0f1c3cd-adaf-4fdf-ac9f-d6c6f3508022]: /192.168.1.100:4300
[2015-09-14 11:31:46,230]  INFO - MemberUtils Added member: Host:192.168.1.100, Remote Host:null, Port: 4300, HTTP:8282, HTTPS:8245, Domain: wso2con.domain, Sub-domain:worker, Active:true

In worker1 node’s console you may see following logs when the worker2 node joins the cluster
[2015-09-14 11:31:44,163]  INFO - WKABasedMembershipScheme Member joined [a0f1c3cd-adaf-4fdf-ac9f-d6c6f3508022]: /192.168.1.100:4300


6 Testing the Cluster setup

Now let us go ahead and test our cluster setup.
  • Go to WSO2_ESB_WORKER_HOME/samples/axis2Server/src/SimpleStockQuoteService and execute following command to install Simple Stock Quote Service to our Axis2 backend server.
ant
  • Then access the the web based management console of the manager node, via the following url.
  • Copy the following proxy configuration to the manager node’s source view
  • Then save the following getQuote request payload into a file named getQuote.xml
  • Then move on to the place where you have saved the above payload and enter the following curl command to send a request pointing the worker node here. The first request points to the worker1 whereas the second request points to the worker2. You may use either of them to test the cluster setup.

curl -v -d @getQuote.xml -H "Content-Type: text/xml; charset=utf-8" -H "SOAPAction:urn:getQuote"  http://esb.wso2con.com:8281/services/ClusterTest

curl -v -d @getQuote.xml -H "Content-Type: text/xml; charset=utf-8" -H "SOAPAction:urn:getQuote"  http://esb.wso2con.com:8282/services/ClusterTest

  • If you need to setup a cluster with a load balancer (Nginx) in front, you may use the article [5]. In such a case you have to direct your client requests to the load balancer.  Just use the load balancer’s port instead of the worker ports used above.


CONCLUSION
In this section I have given you a brief introduction to clustering WSo2 Carbon based products. Then we set up a WSO2 ESb cluster with one manager and two workers. Finally we tested our cluster with a simple synapse configuration. Now we have our cluster setup in our hand. In my next article I will use this cluster setup to explore the Message Processor Coordination support in WSO2 ESB.


References

Comments

Post a Comment

Popular posts from this blog

Introducing Java Reactive Extentions in to a SpringBoot Micro Service

Image
Introduction Today we are going to take a look at Reactive Programming using Java8 and RxJava, which is a library for composing asynchronous and event-based programs by using observable sequences. RxJava stands for Reactive Extensions for the JVM. It extends the observer pattern [Gamma95] to support sequences of data/events and adds operators that allow you to compose sequences together declaratively while abstracting away concerns about things like low-level threading, synchronization, thread-safety and concurrent data structures [1]. Pre-Requisites : Having a good knowledge about Java8, Functional Programming and spring boot microservices. What is Reactive programming? In essence, Reactive programming is an asynchronous programming paradigm concerned with data streams. The system time, a list of entries from the DB/API, user clicks, everything can be a stream of data. Data from different streams can easily be combined and transformed, and in the end processed/observed by the
Read more

Optimal binary search trees

Image
Suppose that we are designing a program to translate text from English to French. For each occurrence of each English word in the text, we need to look up its French equivalent. We could perform these lookup operations by building a binary search tree with $n$ English words as keys and their French equivalents as satellite data. Because we will search the tree for each individual word in the text, we want the total time spent searching to be as low as possible. We could ensure an $Θ(log_2 \;n)$ search time per occurrence by using a red-black tree or any other balanced binary search tree. Words appear with different frequencies, however, and a frequently used word such as the may appear far from the root while a rarely used word appears near the root. Such an organization would slow down the translation, since the number of nodes visited when searching for a key in a binary search tree equals one plus the depth of the node containing the key. We want words that occur frequently in the t
Read more

Edit distance

Image
Biological applications often need to compare the DNA of two (or more) different organisms. A strand of DNA consists of a string of molecules called bases, where the possible bases are adenine, guanine, cytosine, and thymine. Representing each of these bases by its initial letter, we can express a strand of DNA as a string over the finite set $\{A, C, G, T\}$. For example, the DNA of one organism may be $S1 = ACCGGTCGAGTGCGCGGAAGCCGGCCGAA$, and the DNA of another organism may be $S2 = GTCGTTCGGAATGCCGTTGCTCTGTAAA$. One reason to compare two strands of DNA is to determine how “similar” the two strands are, as some measure of how closely related the two organisms are. We can, and do, define similarity in many different ways. For example, we can say that two strands are similar if the number of changes needed to turn one into the other is small. [1] We formalize this notion of similarity in our Edit distance problem. 15-5 Edit distance - Problem Statement In order to transform one sour
Read more